Frequently Asked Questions

FREQUENTLY ASKED QUESTIONS

Why is there a difference between the major DNA testing companies in their measuring of the marker GATA H4?

Concerning the discrepancy between FTDNA on the one hand and Relative Genetics and DNA Heritage on the other in regards to the marker GATA H4. It seems that the latter two companies have changed the name of the marker to TAGA H4 to reflect their methodology in reporting that marker. If you look at the line TAGATAGATAGATAGATAGA and count the repeats of the sequence TAGA (as RG and DNA Heritage do) you come of with 5 repeats. FTDNA would count the repeats of GATA and report the series as a 4. This is why FTDNA's alelle values on this marker are consistantly one below the those reported by the other two companies.

Can the the DNA testing being done for this project be used in a criminal or medical search?

The DNA used for our website is from the non-recombining (practically all) part of the y-chromosome. Specifically, it is dna whose purpose is to separate one gene (also made from DNA) from another. It does not give any information, on its own, about the genetic make-up of the individual concerned. At the current number of DNA markers being tested, there must be verification of some sort by a paper trail for it to have any use, even for genealogical studies. For this reason, it is commonly referred to as "junk DNA."
In the case of genetic genealogy, junk DNA can be a powerful tool in interpreting other evidence already available, because, even though it is strictly inherited from father-to-son, it is subject to mutation just like any other DNA. This means that "junk DNA" can be used to determine if two individuals have a common ancestor in the male-line and can provide a basis for calculating when the MRCA (most recent common ancestor) might have lived. If there is no other evidence available, however, one could look at this level of two identical test results and not know if they were from the same person or from two individuals separated by 10 to 20 generations, nor would it be possible to know whether the two individuals concerned had the same family name or not, or even whether they were of the same race. The value of using "junk DNA" in genetic genealogy lies solely in its ability to help people better interpret the written record. By itself, it is useless for forensic or medical purposes, except as a means of eliminating general classes of people as would be represented on this website by what we call haplotype sets (subclades).

The situation, however, is different with regard to autosomal DNA (the DNA of the very tiny recombining part of the y-chromosome and of all the other chomosomes). Each person (other than identical twins) has a unique genetic signature, which, once known, can be used to help solve crimes or to establish relationships between parents and children or between children. It cannot be used, however, to establish relationships of a more distant nature with any great degree of certainty.

As for its possible use in revealing medical conditions. This is not absolutely impossible. In the case of the marker s 464a, 464b, 464c, and 463d, they can in extremely rare cases indicate that a person is missing a gene, the lack of which sometimes (though not always) causes infertility in men. Obviously, if there is no genetically determined condition of infertility common in one's male line, then the markers mentioned immediately above will have no meaning.

The conclusion is that the level of DNA testing being used for this website is not enough to use as the basis of a criminal investigation. Likewise, for over 99.9% of the world there is no presently known genetically determined medical problem which could be revealed by the markers currently being used in genetic genealogy.